View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5448_high_35 (Length: 237)
Name: NF5448_high_35
Description: NF5448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5448_high_35 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 19 - 218
Target Start/End: Original strand, 8726386 - 8726585
Alignment:
| Q |
19 |
caatggagaacatcatgaattttggaatcaggaggcaaggccagtttgtaagcaacctgtccaatccattccataatcaaataaggaccgtagaaacgtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8726386 |
caatggagaacatcatgaattttggaatgaggaggcaaggccagtttgtaagcaacctgtccaatccgttccataatcaaataaggaccgtagaaacgtt |
8726485 |
T |
|
| Q |
119 |
taacgatccgcaggtgctgccactaggcatgtgtttgttttaggaatttcaccattataagataggcaaattaagtttccagaattcacatggatttgca |
218 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8726486 |
taacgatccgtaggtgctgccactaggcatgtgtttgttttaggaatttcaccattataagataggcaaattaagttttcagaattcacatggatttgca |
8726585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University