View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5448_high_40 (Length: 234)
Name: NF5448_high_40
Description: NF5448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5448_high_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 8e-42; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 130 - 216
Target Start/End: Complemental strand, 30907986 - 30907900
Alignment:
| Q |
130 |
ccctttgttatttacttgtttattttttaatatgaattcttccgatgtaaatttagtgcatactaatttaatacaccttgaatccaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30907986 |
ccctttgttatttacttgtttattttttaatatgaattcttccgatgtaaatttagtgcatactaatttaatacaccttgaatccaa |
30907900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 84
Target Start/End: Original strand, 5924201 - 5924237
Alignment:
| Q |
48 |
tattttttacaaacgcggatatgaggatggatactat |
84 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
5924201 |
tattttttacaaacgcggatatggggatgggtactat |
5924237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 84
Target Start/End: Original strand, 9355305 - 9355341
Alignment:
| Q |
48 |
tattttttacaaacgcggatatgaggatggatactat |
84 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||| |
|
|
| T |
9355305 |
tattttttacaaacgtgggtatgaggatggatactat |
9355341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 84
Target Start/End: Complemental strand, 36072594 - 36072558
Alignment:
| Q |
48 |
tattttttacaaacgcggatatgaggatggatactat |
84 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
36072594 |
tattttttacaaacgcgggtatggggatggatactat |
36072558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 50 - 84
Target Start/End: Complemental strand, 30774769 - 30774735
Alignment:
| Q |
50 |
ttttttacaaacgcggatatgaggatggatactat |
84 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30774769 |
ttttttacaaacgcggatatggggatggatactat |
30774735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 47 - 84
Target Start/End: Original strand, 33347217 - 33347254
Alignment:
| Q |
47 |
atattttttacaaacgcggatatgaggatggatactat |
84 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
33347217 |
atattttttacaaacgcggatatggggatgggtactat |
33347254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 84
Target Start/End: Original strand, 639504 - 639540
Alignment:
| Q |
48 |
tattttttacaaacgcggatatgaggatggatactat |
84 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
639504 |
tattttttacaaacgcggatataaggatgggtactat |
639540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 85
Target Start/End: Original strand, 40094652 - 40094690
Alignment:
| Q |
47 |
atattttttacaaacgcggatatgaggatggatactatg |
85 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
40094652 |
atattttttacaaacgcgggtatggggatggatactatg |
40094690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 48 - 84
Target Start/End: Complemental strand, 31786394 - 31786358
Alignment:
| Q |
48 |
tattttttacaaacgcggatatgaggatggatactat |
84 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
31786394 |
tattttttacaaacgcgggtatgaggatgaatactat |
31786358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 20 - 83
Target Start/End: Complemental strand, 8340142 - 8340078
Alignment:
| Q |
20 |
attaaagttgttgtccacaaggatac-gatattttttacaaacgcggatatgaggatggatacta |
83 |
Q |
| |
|
|||||||||||| | ||| ||| ||| || ||||||||||||||||| |||| |||||||||||| |
|
|
| T |
8340142 |
attaaagttgtttttcacgagggtacagacattttttacaaacgcgggtatggggatggatacta |
8340078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 81
Target Start/End: Complemental strand, 15161947 - 15161915
Alignment:
| Q |
49 |
attttttacaaacgcggatatgaggatggatac |
81 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
15161947 |
attttttacaaacgcggatatggggatggatac |
15161915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University