View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5448_low_37 (Length: 237)
Name: NF5448_low_37
Description: NF5448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5448_low_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 77 - 221
Target Start/End: Complemental strand, 33989484 - 33989339
Alignment:
| Q |
77 |
gagccaacgaaggcaatatccataagacaactaaaatgattgcgagtctcacgagttaccatctcatcaatagagttgacacatttccagaagctgc-ta |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| | || |
|
|
| T |
33989484 |
gagccaacgaaggcaatatccataagacaactaaaatgattgcgagtctcacaagttaccatctcatcgatagagttgacacatttccagaagctccata |
33989385 |
T |
 |
| Q |
176 |
atagatttagctttatttgataacaatctctgatttcttttattct |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33989384 |
atagatttagctttatttgataacaatctctgatttctttcattct |
33989339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University