View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5448_low_39 (Length: 236)
Name: NF5448_low_39
Description: NF5448
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5448_low_39 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 5 - 226
Target Start/End: Original strand, 13918939 - 13919160
Alignment:
| Q |
5 |
acaagggtgatgaacatgaaagtggaggctggaaaggaaccaccttatgctggtgctttggattgtgctttgaaaacagttcgtgctgagggtcctctgg |
104 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| |
|
|
| T |
13918939 |
acaagggtgatgaacatgaaggtggaggctggaaaggaaccaccctatgctggtgctttggattgtgctttgaagacagttcgtgctgagggtcctatgg |
13919038 |
T |
|
| Q |
105 |
ctctatacaagggatttattcctacaatttcaaggcagggacctttcactgttgttctgtttgttactttggagcaagttcgcaagttgttgaaggattt |
204 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13919039 |
ctctttacaagggatttattcctacaatttcaaggcagggacctttcactgttgttctgtttgttactttggagcaagttcgcaagttgttgaaggattt |
13919138 |
T |
|
| Q |
205 |
ctgagttgctagattgatgatg |
226 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
13919139 |
ctgagttgctagattgatgatg |
13919160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 8 - 206
Target Start/End: Original strand, 28830184 - 28830382
Alignment:
| Q |
8 |
agggtgatgaacatgaaagtggaggctggaaaggaaccaccttatgctggtgctttggattgtgctttgaaaacagttcgtgctgagggtcctctggctc |
107 |
Q |
| |
|
||||||||||| ||||| |||||||||||| | |||||||| | ||||| | |||||||||||||| || ||||||||||||||||| |||||| |
|
|
| T |
28830184 |
agggtgatgaatatgaaggtggaggctggatcgcctccaccttactccggtgccattgattgtgctttgaagactattcgtgctgagggtcctatggctc |
28830283 |
T |
|
| Q |
108 |
tatacaagggatttattcctacaatttcaaggcagggacctttcactgttgttctgtttgttactttggagcaagttcgcaagttgttgaaggatttct |
206 |
Q |
| |
|
| || ||||| ||||||||||||||| ||||||||||||| || || ||||| |||||||||| ||||| || ||||| |||||| | |||||||||| |
|
|
| T |
28830284 |
tttataagggttttattcctacaattacaaggcagggaccgtttaccgttgtgttgtttgttacattggaacaggttcgtaagttgcttaaggatttct |
28830382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 102 - 168
Target Start/End: Original strand, 46255127 - 46255193
Alignment:
| Q |
102 |
tggctctatacaagggatttattcctacaatttcaaggcagggacctttcactgttgttctgtttgt |
168 |
Q |
| |
|
||||||| || ||||| |||||||||||||||||||| ||||| ||||| ||||||||||| ||||| |
|
|
| T |
46255127 |
tggctctttataagggttttattcctacaatttcaagacagggtccttttactgttgttctttttgt |
46255193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University