View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5449_high_2 (Length: 296)
Name: NF5449_high_2
Description: NF5449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5449_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 249
Target Start/End: Complemental strand, 35410099 - 35409851
Alignment:
| Q |
1 |
ggcggttccagatgccactcagccacatggcattagactacttattgaagattatccttatgcggctgatggactcctcatatggactagtatagagaag |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35410099 |
ggcggttccagatgccactcggccacatggcattagactacttattgaagattatccttatgcggctgatggactcctcatatggtctagtatagagaag |
35410000 |
T |
 |
| Q |
101 |
ttggtcaggacctatgtgaaccattactacaaagatttgaatgccgtttcttctgacaatgaactccagtcctggtacaaagaattcatcaacatggggc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35409999 |
ttggtcaggacctatgtgaaccattactacaaagatttgaatgccatttcttctgacaatgaactccagtcctggtacaaagaattcatcaacatggggc |
35409900 |
T |
 |
| Q |
201 |
accctgatcataaaaatgctacctggtggcctaaactaaacacccctga |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35409899 |
accctgatcataaaaatgctacctggtggcctaaactaaacacccctga |
35409851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University