View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5449_low_4 (Length: 279)
Name: NF5449_low_4
Description: NF5449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5449_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 11 - 181
Target Start/End: Complemental strand, 14754582 - 14754412
Alignment:
| Q |
11 |
caaaggcttgaaagtttgttgatcaagatcataaatatgttgtatatgtgtaatagtttgcatatactaaaaaattgttacatacaaatctcttattctt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14754582 |
caaaggcttgaaagtttgttgatcaagatcacaaatatgttgtatatgtgtaatagtttgcatatactaaaaaattgttacatacaaatctcttattctt |
14754483 |
T |
|
| Q |
111 |
ttatatgtctgtaattgaatttgctttgcttagtttgatgcatgtgaaaatgtgtatgtttatggtgaatc |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14754482 |
ttatatgtctgtaattgaatttgctttgcttagtttgatgcatgtgaaaatgtgaatgtttatggtgaatc |
14754412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 208 - 264
Target Start/End: Complemental strand, 14754385 - 14754329
Alignment:
| Q |
208 |
aatgtcaaggaattgtgactttggattggatcaaatggttcattcaatcctttatgt |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14754385 |
aatgtcaaggaattgtgactttggattggatcaaatggttcattcaatcctttatgt |
14754329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University