View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5450_high_16 (Length: 252)
Name: NF5450_high_16
Description: NF5450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5450_high_16 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 6 - 252
Target Start/End: Complemental strand, 36989626 - 36989385
Alignment:
| Q |
6 |
aggagcagagatctaggctagctgctggggtttgtaaatttgtaatcattatgttggttgaatttcattatagagctacactgagaattttgtcttggct |
105 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36989626 |
aggaacagagatctaggctagctg---gggtttgtaaatttgtaatcattatgtcagttgaatttcattatag--ctacactgagaattttgtcttggct |
36989532 |
T |
 |
| Q |
106 |
ttgagagcctggagccttattatttgttgcatcaaatgatgatcatatgctgagtactgatatgtgtcagctgagtccaaaggacacaaacccagctccc |
205 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36989531 |
tggagagcctggagccttattatttgttgcatcaaatgatgatcatatgctgagtactgatatgtgtcagctgagtccaaaggacacaaacccagctccc |
36989432 |
T |
 |
| Q |
206 |
ctgcagtcaacatgcccccggcacgtcaagatggcttaattaagatc |
252 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
36989431 |
ctgcagtcaacatgcctccggcacgtcaagatggtttaattaagatc |
36989385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University