View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5450_high_23 (Length: 222)
Name: NF5450_high_23
Description: NF5450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5450_high_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 1 - 184
Target Start/End: Complemental strand, 10011662 - 10011479
Alignment:
| Q |
1 |
tttcccacgtatgttcacacactaaaccagcatctatcataacnnnnnnnattctagctcttcttcccatgctaactataggaatcacagtgctctcttc |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10011662 |
tttcccacgcatgttcacacactaaaccagcatctatcataactttttttattctagctcttcttcccatgctaactttaggaatcacagtgctctcttc |
10011563 |
T |
 |
| Q |
101 |
ccttggttcaacaacacagcatccatccaactcttcaacgccatctccatagctgcatgttctccgccagaatccttcatcaac |
184 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10011562 |
ccttggttcaacagcacagtatccatccaactcttcaatgccatctccatagctgcatgttctccgccagaatctttcatcaac |
10011479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University