View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5450_low_16 (Length: 252)

Name: NF5450_low_16
Description: NF5450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5450_low_16
NF5450_low_16
[»] chr8 (1 HSPs)
chr8 (6-252)||(36989385-36989626)


Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 6 - 252
Target Start/End: Complemental strand, 36989626 - 36989385
Alignment:
6 aggagcagagatctaggctagctgctggggtttgtaaatttgtaatcattatgttggttgaatttcattatagagctacactgagaattttgtcttggct 105  Q
    |||| |||||||||||||||||||   |||||||||||||||||||||||||||  |||||||||||||||||  |||||||||||||||||||||||||    
36989626 aggaacagagatctaggctagctg---gggtttgtaaatttgtaatcattatgtcagttgaatttcattatag--ctacactgagaattttgtcttggct 36989532  T
106 ttgagagcctggagccttattatttgttgcatcaaatgatgatcatatgctgagtactgatatgtgtcagctgagtccaaaggacacaaacccagctccc 205  Q
    | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36989531 tggagagcctggagccttattatttgttgcatcaaatgatgatcatatgctgagtactgatatgtgtcagctgagtccaaaggacacaaacccagctccc 36989432  T
206 ctgcagtcaacatgcccccggcacgtcaagatggcttaattaagatc 252  Q
    |||||||||||||||| ||||||||||||||||| ||||||||||||    
36989431 ctgcagtcaacatgcctccggcacgtcaagatggtttaattaagatc 36989385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University