View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5450_low_9 (Length: 349)
Name: NF5450_low_9
Description: NF5450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5450_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 1 - 333
Target Start/End: Complemental strand, 36989226 - 36988897
Alignment:
| Q |
1 |
ctactagattcctctatcccttataattgatggagctgacataacttaacnnnnnnnngttggtggtggtgggtggtgctgcttgtctagtgggtgtgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36989226 |
ctactagattcctctatcccttataattgatggagctgacataacttaacttttttt-gttggtggtggtgggtggtgctgcttgtctagtgggtgtgga |
36989128 |
T |
 |
| Q |
101 |
tagcaattggcactcaatttgaaacattacaacaactatatatgatatgatcgtggcctcgtagtaattctaaatcgaaactactagtatatatgcttct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36989127 |
tagcaattggcactcaatttgaaacattacaacaactatatatgatatgatcgtggcctcgtagtaattctaaatcgaaactactagtatat--gcttct |
36989030 |
T |
 |
| Q |
201 |
tggaatcctatgcttgaaggggacccaaaatatttctggtgcaattggaacttttaactagtggaagcacatgcaatgcaaattgtaaccacaaggtctt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36989029 |
tggaatcctatgcttgaaggggacccaaaatatttctggtgcaattggaacttttaactagtggaagcacatgcaatgcaaattgtaaccacaatgtctt |
36988930 |
T |
 |
| Q |
301 |
aaatttgatttaaactcgtagaaaggtggaact |
333 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
36988929 |
aaatttgatttaaactcatagaaaggtggaact |
36988897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University