View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5452-Insertion-4 (Length: 200)
Name: NF5452-Insertion-4
Description: NF5452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5452-Insertion-4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 77; Significance: 6e-36; HSPs: 7)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 8 - 84
Target Start/End: Complemental strand, 51030550 - 51030474
Alignment:
| Q |
8 |
caaggggggtgttctgctttagaggatggagtggttttagcaaggtgtttagccgaggccttttcgaagaaaccaaa |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51030550 |
caaggggggtgttctgctttagaggatggagtggttttagcaaggtgtttagccgaggccttttcgaagaaaccaaa |
51030474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 8 - 84
Target Start/End: Complemental strand, 51063302 - 51063226
Alignment:
| Q |
8 |
caaggggggtgttctgctttagaggatggagtggttttagcaaggtgtttagccgaggccttttcgaagaaaccaaa |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51063302 |
caaggggggtgttctgctttagaggatggagtggttttagcaaggtgtttagccgaggccttttcgaagaaaccaaa |
51063226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 8 - 69
Target Start/End: Complemental strand, 51068871 - 51068810
Alignment:
| Q |
8 |
caaggggggtgttctgctttagaggatggagtggttttagcaaggtgtttagccgaggcctt |
69 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
51068871 |
caaggggggtgttctgctttagaggatggggtggttttagcaaggtgtctagctgaggcctt |
51068810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 152 - 200
Target Start/End: Complemental strand, 51030412 - 51030364
Alignment:
| Q |
152 |
tggagatgcattgatctcattactgcatcttatattgtgggttatattc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51030412 |
tggagatgcattgatctcattactgcatcttatattgtgggttatattc |
51030364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 45; E-Value: 7e-17
Query Start/End: Original strand, 8 - 84
Target Start/End: Complemental strand, 51034828 - 51034752
Alignment:
| Q |
8 |
caaggggggtgttctgctttagaggatggagtggttttagcaaggtgtttagccgaggccttttcgaagaaaccaaa |
84 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||||||||||||| |||| |||| ||||| ||||||||||| |
|
|
| T |
51034828 |
caaggggggtgttgtgctttagaggatggggtggttttagcaaggtgcttaggtgaggtattttccaagaaaccaaa |
51034752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 8 - 60
Target Start/End: Original strand, 40618110 - 40618162
Alignment:
| Q |
8 |
caaggggggtgttctgctttagaggatggagtggttttagcaaggtgtttagc |
60 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||| ||||||||||| ||||| |
|
|
| T |
40618110 |
caaggggggtgttctgctttagaagatggggtggtattagcaaggtgcttagc |
40618162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 152 - 200
Target Start/End: Complemental strand, 51063152 - 51063104
Alignment:
| Q |
152 |
tggagatgcattgatctcattactgcatcttatattgtgggttatattc |
200 |
Q |
| |
|
|||||||||||||||||||||| |||| |||| ||||||||| ||||| |
|
|
| T |
51063152 |
tggagatgcattgatctcattattgcaaattattttgtgggttctattc |
51063104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University