View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5452_high_6 (Length: 243)
Name: NF5452_high_6
Description: NF5452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5452_high_6 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 7 - 243
Target Start/End: Complemental strand, 52079325 - 52079093
Alignment:
| Q |
7 |
ccatgcaccggtatgtgacaattacttgctcattaagctcttattttaaccaattttaataaaatcagcttcacaattttatttagggctcatcactgat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52079325 |
ccatgcaccggtatgtgacaattacttgctcattaagctcttattttaaccaattttaataaaatcagcttcacaattttatttagggctcatcactgat |
52079226 |
T |
 |
| Q |
107 |
cgaccaatctatagttataaatcatccaatccaactcatccagttcggtagagatagaaatgatctgtaaaaatagaaaataaaatagtagattgatagg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
52079225 |
cgaccaatctatagttataaatcatccaatccaactcatccagttcggtagagatagaaatgatttgtaaaaatagaaaataaaatagtagattgatagg |
52079126 |
T |
 |
| Q |
207 |
atgggtcggtcgggtattgatacactcaaattgattt |
243 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
52079125 |
atggg----tcgggtattgatacactcaaattgattt |
52079093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University