View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5453_low_10 (Length: 246)
Name: NF5453_low_10
Description: NF5453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5453_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 6e-86; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 19 - 232
Target Start/End: Original strand, 35408907 - 35409114
Alignment:
| Q |
19 |
tgttccatctggaacttatggcaacaaacaagaatgtgatccgtgctataacaactggaaaactaaggaaggaaaaccaaagtgcccctaattcatgata |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35408907 |
tgttccatctggaacttatggcaacaaacaagaatgt---ccgtgctataacaactggaaaactaaggaaggaaaaccgaagtgcccctaattcatg--- |
35409000 |
T |
 |
| Q |
119 |
attttttgctcccacacggctcgtttgtgagccgtgaggggttgcctctttcgnnnnnnncgtgtttactcctctgatttggactcaagtattgcttgtg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35409001 |
attttttgctcccacacggctcgtttgtgagccgtgaggggttgcctctttcgtttttttcgtgtttactcctctgatttggactcaagtattgcttgtg |
35409100 |
T |
 |
| Q |
219 |
ctcattgtatctcc |
232 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
35409101 |
ctcattgtatctcc |
35409114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 23 - 117
Target Start/End: Complemental strand, 20872098 - 20872007
Alignment:
| Q |
23 |
ccatctggaacttatggcaacaaacaagaatgtgatccgtgctataacaactggaaaactaaggaaggaaaaccaaagtgcccctaattcatgat |
117 |
Q |
| |
|
||||| ||||||||||| ||||| |||| ||| || ||||||||||||||||||||| | |||||||| ||||| |||||||| || ||||| |
|
|
| T |
20872098 |
ccatccggaacttatggtaacaaggaagagtgt---ccatgctataacaactggaaaactcaagaaggaaatccaaaatgcccctagttgatgat |
20872007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University