View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5453_low_13 (Length: 233)

Name: NF5453_low_13
Description: NF5453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5453_low_13
NF5453_low_13
[»] chr5 (1 HSPs)
chr5 (3-224)||(13918584-13918805)
[»] chr8 (1 HSPs)
chr8 (1-214)||(28829836-28830049)


Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 3 - 224
Target Start/End: Complemental strand, 13918805 - 13918584
Alignment:
3 gccagctgtgaagctgggaccagcatggcgcggttgacagttaatgatgacccgcgccagagactggtcacaccttcctgcttcgccattctagtaatgg 102  Q
    |||||||||||||||| |||||||||||||||||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||    
13918805 gccagctgtgaagctgtgaccagcatggcgcggttcacagtcaatgatgacccgcgccagagactagtcacaccttcctgcttcgccattctggtaatgg 13918706  T
103 cgtcgacaacagatttgtagtttctctgctgagccggtggaagtctcccatcggcttgcattcgaaccatggcaacatcggcaggattaccgatagcagc 202  Q
    |||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||    
13918705 cgtcaacaacagatttgtagtttctctgctgagccggtgggagtctcccatcggcttgcattcgaaccatggcaacatcggcggggttaccgatagcagc 13918606  T
203 accaaccccaccagcaataagt 224  Q
    ||||||||||||||||||||||    
13918605 accaaccccaccagcaataagt 13918584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 28830049 - 28829836
Alignment:
1 atgccagctgtgaagctgggaccagcatggcgcggttgacagttaatgatgacccgcgccagagactggtcacaccttcctgcttcgccattctagtaat 100  Q
    ||||||||||||| || |  |||| |||||||||||| || || |  ||||| |||||||| || || || || || || |  |||||||| || |  ||    
28830049 atgccagctgtgatgcggtaaccaacatggcgcggttcactgtcagagatgaaccgcgccataggctagtaactccctcgtctttcgccatcctggagat 28829950  T
101 ggcgtcgacaacagatttgtagtttctctgctgagccggtggaagtctcccatcggcttgcattcgaaccatggcaacatcggcaggattaccgatagca 200  Q
    ||||||||| |||||||| ||||||||    || |||| ||||||||| |||||||| ||||| | |||||| || ||||| || ||||| |||| |||     
28829949 ggcgtcgacgacagatttatagtttcttctttgggccgatggaagtcttccatcggcctgcatcctaaccattgccacatcagccggattcccgacagcc 28829850  T
201 gcaccaaccccacc 214  Q
    || |||| ||||||    
28829849 gcgccaatcccacc 28829836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University