View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5453_low_6 (Length: 279)
Name: NF5453_low_6
Description: NF5453
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5453_low_6 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 9 - 279
Target Start/End: Complemental strand, 35409365 - 35409095
Alignment:
| Q |
9 |
attattctttgtctttttatatcaaaagttgcatagataactcgtgataagctagaaaaattgctacaaattcagttgcatgatcaagagtacgctaatt |
108 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35409365 |
attattcattgtctttttatatcaaaagttgcatagataactcgtgataagctagaaaaattgctacaaattcagttgcatgatcaagagtacgctaatt |
35409266 |
T |
 |
| Q |
109 |
ttttgtgnnnnnnnnnnnnnnnnnngagtatgcaatattaaagcaacttcaattagagatactttggttatccttcattagttttcccattacttttgtt |
208 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35409265 |
ttttgtgaaaaaaataaaatgaaaagagtatgcaatattaaagcaacttcaattagagatactttggttatccttcattagttttcccattacttttgtt |
35409166 |
T |
 |
| Q |
209 |
ttttgaatagcaaaaaatattgttaataatnnnnnnntcaagctgaacaaaggagatacaatgagcacaag |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
35409165 |
ttttgaatagcaaaaaatattgttaataataaaaaaatcaagctgaacaacggagatacaatgagcacaag |
35409095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University