View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5454-Insertion-10 (Length: 98)
Name: NF5454-Insertion-10
Description: NF5454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5454-Insertion-10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 80; Significance: 4e-38; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 4e-38
Query Start/End: Original strand, 5 - 88
Target Start/End: Complemental strand, 32517220 - 32517137
Alignment:
| Q |
5 |
acaatttcatcataggattccaatgtaatgttgaaacctctactgttatttctattgagttttggggtttttacatgggtttat |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32517220 |
acaatttcatcataggattccaatgtaatgttgaaacctctactgttatttctattgagttttggggtctttacatgggtttat |
32517137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University