View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5454_low_14 (Length: 245)
Name: NF5454_low_14
Description: NF5454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5454_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 51104665 - 51104897
Alignment:
| Q |
1 |
cagtgttcaacccaactttctgcttgggacctcatttggagcttagttactgaacattatttattaggatttatttctatgaatggcatctattagaaga |
100 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||||||| ||||||| |||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
51104665 |
cagtgttcaaccgaactgtctgcttgggacctcatttggagctgagttacttaacattatttatcagtatttatttctatgaatggcatctattagaaga |
51104764 |
T |
 |
| Q |
101 |
accttgtctcctgttcctctacccgcaactgcagcaaatgtagatgtctgttcagtatcttccccgttgtctaagtcctcacctagcccccagaagtttg |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51104765 |
accttgtctcctgttcctcgacccgcaactgcagcaaatgtagatgtctgttcagtatcttccccgttgtctaagtcctcacctagcccccagaagtttt |
51104864 |
T |
 |
| Q |
201 |
ttccatcctatggatttttaccttcttcattca |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
51104865 |
ttccatcctatggatttttaccttcttcattca |
51104897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University