View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5454_low_17 (Length: 240)
Name: NF5454_low_17
Description: NF5454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5454_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-113; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 28290733 - 28290953
Alignment:
| Q |
1 |
ctaaccaacttctggagcaaaaggggtttggtcccatagattggcaactataatttgtatgtggagttaccgatgattttttgaacttgtttccctcgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
28290733 |
ctaaccaacttctggagcaaaaggggtttgatcccatagattggcaactataatttgtatgtggagtt-ccggtgattttttgaacttgtttccctcgat |
28290831 |
T |
 |
| Q |
101 |
gtattgacggttatgtagattcgaaaaggaggaaaagtggtgcttttgttgatagtttgaccttgcagtgttgtttcttaccttgaatattttgcagtac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28290832 |
gtattgacggttatgtagattcgaaaaggaggaaaagtggtgcttttgttgatagtttgaccttgcagtgttgtttcttaccttgaatattttgcagtac |
28290931 |
T |
 |
| Q |
201 |
cgaccaatactagtagcaattt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
28290932 |
cgaccaatactagtagcaattt |
28290953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 11 - 54
Target Start/End: Original strand, 28304951 - 28304994
Alignment:
| Q |
11 |
tctggagcaaaaggggtttggtcccatagattggcaactataat |
54 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
28304951 |
tctggagcaaatgggcattggtcccatagattggcaactataat |
28304994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 68
Target Start/End: Original strand, 19251356 - 19251410
Alignment:
| Q |
14 |
ggagcaaaaggggtttggtcccatagattggcaactataatttgtatgtggagtt |
68 |
Q |
| |
|
|||||||| |||| |||||||||||| |||||||||||||| | ||||| ||||| |
|
|
| T |
19251356 |
ggagcaaagggggattggtcccatagtttggcaactataatctatatgtagagtt |
19251410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University