View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5454_low_7 (Length: 278)
Name: NF5454_low_7
Description: NF5454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5454_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 24 - 267
Target Start/End: Original strand, 45642103 - 45642346
Alignment:
| Q |
24 |
cccccacacctccaatcacatgcaaaccttacatttacatgcctcacatctcaaccccattcctctctcccacaccatgctatctacttatgaaacatca |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45642103 |
cccccacacctccaatcacatgcaaaccttacatttacaagcctcacatctcaaccctattcctctctcccacaccatgctatctacttatgaaacatca |
45642202 |
T |
 |
| Q |
124 |
atgctccttttcctctccatgtgaaatgtgtttcaccttcaaccctttgacgtgatgaaactgcacctttcgaccttcaaccgtcacgcttccaccttca |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
45642203 |
atgctccttttcctctccatgtgaaatgtgtttcaccttcaaccctttgacgtgatgaaactgcacctttcaaccttcaaccttcacgcttccaccttca |
45642302 |
T |
 |
| Q |
224 |
tgcttcgtgtttcagcaacctttgtgtttgcacctccattctct |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45642303 |
tgcttcgtgtttcagcaacctttgtgtttgcacctccattctct |
45642346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University