View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5456-Insertion-2 (Length: 84)
Name: NF5456-Insertion-2
Description: NF5456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5456-Insertion-2 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 56; Significance: 7e-24; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 56; E-Value: 7e-24
Query Start/End: Original strand, 8 - 84
Target Start/End: Complemental strand, 7605688 - 7605612
Alignment:
| Q |
8 |
catctctagttttacttgagtttcatttttgttgcnnnnnnnccaaatataaattgtttctcaatattgattctaag |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7605688 |
catctctagttttacttgagtttcatttttgttgctttttttccaaatataaattgtttctcaatattgattctaag |
7605612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 84
Target Start/End: Original strand, 8942355 - 8942430
Alignment:
| Q |
8 |
catctctagttttacttgagtttcatttttgttgcnnnnnnnccaaatataaattgtttctcaatattgattctaag |
84 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || || |||||||||||||||||||||||||||| |
|
|
| T |
8942355 |
catctctagttttacttgcgtttcatttttgttg-tttttttcctgatctaaattgtttctcaatattgattctaag |
8942430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 42
Target Start/End: Original strand, 38714796 - 38714829
Alignment:
| Q |
9 |
atctctagttttacttgagtttcatttttgttgc |
42 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
38714796 |
atctttagttttacttgagtttcatttttgttgc |
38714829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University