View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5457-Insertion-6 (Length: 190)
Name: NF5457-Insertion-6
Description: NF5457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5457-Insertion-6 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 8 - 190
Target Start/End: Complemental strand, 1239462 - 1239280
Alignment:
| Q |
8 |
aatatctcactgagtttcatgcatagcagcatgcagtagaggcaaacccttattattgaggcccacgaagaccaatttcgcacgtgtcaaataagaagct |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1239462 |
aatatctcactgagtttcatgcatagcagcatgcagtagaggcaaacccttattattgaggcccacgaagaccaatttcgcacgtgtcaaataagaagct |
1239363 |
T |
|
| Q |
108 |
aaaacgtgtaagtttttctatagtaacaacgtagatgatgacgtgtaagtaaccaaacaaacgaacactgccgctttaattca |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1239362 |
aaaacgtgtaagtttttctatagtaacaacgtagatgatgacgtgtaagtaaccaaacaaacaaacactgccgctttaattca |
1239280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University