View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5457_low_2 (Length: 357)
Name: NF5457_low_2
Description: NF5457
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5457_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 6e-93; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 6e-93
Query Start/End: Original strand, 152 - 340
Target Start/End: Complemental strand, 27245082 - 27244895
Alignment:
| Q |
152 |
taattggtaagtatgtatcatctaaacattgattcaaaccttttctaatgcgtcttctgcattttgggcaatcttctctacatcttctgctacgttttca |
251 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27245082 |
taattggta-gtatgtatcatctaaacattgattcaaaccttttctaatgcgtcttctgcattttgagcaatcttctctacatcttctgctacgttttca |
27244984 |
T |
 |
| Q |
252 |
acaaattcagcaacaactcgtcgttttcctttgggaagattctttacagttctttctgccatcttgtccaccctttcagccacttcttc |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27244983 |
acaaattcagcaacaactcgtcgttttcctttgggaagattctttgcagttctttctgccatcttgtccaccctttcagccacttcttc |
27244895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 15 - 73
Target Start/End: Complemental strand, 27245257 - 27245199
Alignment:
| Q |
15 |
ggacaaagacatatcacatatgccaaactaagcagaaactaagacgtaaagaatgtctt |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27245257 |
ggacaaagacatatcacatatgccaaactaagcagaaactaagacgtaaagaatgtctt |
27245199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 120 - 160
Target Start/End: Complemental strand, 27245152 - 27245112
Alignment:
| Q |
120 |
cccatggacatataaattatgtttcttaaaagtaattggta |
160 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27245152 |
cccatggacgtataaattatgtttcttaaaagtaattggta |
27245112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University