View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5458-Insertion-8 (Length: 191)
Name: NF5458-Insertion-8
Description: NF5458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5458-Insertion-8 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 67; Significance: 5e-30; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 67; E-Value: 5e-30
Query Start/End: Original strand, 110 - 191
Target Start/End: Original strand, 38823537 - 38823623
Alignment:
| Q |
110 |
gacacaaccacaagacactaaaatcaatggcaattttcaatagtttgattataa-----tacttacaaattaactcgtgatagaatg |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
38823537 |
gacacaaccacaagacactaaaatcaatggcaattttcaatagtttgattataataaggtacttacaaattaactcgtgatagaatg |
38823623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 8e-29
Query Start/End: Original strand, 8 - 88
Target Start/End: Original strand, 38823432 - 38823512
Alignment:
| Q |
8 |
ggtcgaacctctgttgcgacttatcatcaataactttggttgttcttcggtaccttatatgagggtatgcgtttctgaatc |
88 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||| |||||||||| |
|
|
| T |
38823432 |
ggtcgaacctctattgcgacttatcatcaataactttggttgttcttccgtaccttatatgagggtgtgcatttctgaatc |
38823512 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University