View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5458_high_11 (Length: 238)
Name: NF5458_high_11
Description: NF5458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5458_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 41705359 - 41705132
Alignment:
| Q |
1 |
gatttaaggaggtggtgggttgtgttgaattctattatggagagtgagtgtgttagaggtaatagtagcatttgagatgaagaatgtgaaatgaagagtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41705359 |
gatttaaggaggtggtgggttgtgttgaattctatcatggagagtgagtgtgttagaggtaatagtagcatttgagatgaagaatgtgaaatgaagagtg |
41705260 |
T |
|
| Q |
101 |
tgatgatgaggagaaataacaggggagaagccatttggttaaaca--gtatttgnnnnnnnngtgttggaacttgaatacagagagaggagaagagtttt |
198 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41705259 |
tgatgaggaggagaaataacaggggagaagccatttggttaaacagggtatttg-tttttttgtgttggaacttgaatac--agagaggagaagagtttt |
41705163 |
T |
|
| Q |
199 |
tgaatttgtagatggagtggtgtgtgatgat |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
41705162 |
tgaatttgtagatggagtggtgtgtgatgat |
41705132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University