View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5458_low_7 (Length: 290)
Name: NF5458_low_7
Description: NF5458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5458_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 43 - 273
Target Start/End: Original strand, 43927942 - 43928154
Alignment:
| Q |
43 |
ttaaatagttggtacttggtaccccaatccttgtatcaaaattacatatatatgattatgattataatcataattgaaacatggataaagattaagtttt |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43927942 |
ttaaatagttggtacttggtaccccaatccttgtatcaaaattacatatatatgattatgattataatcataattgaaacatggataaagattaagtttt |
43928041 |
T |
 |
| Q |
143 |
gtaaattatgttataaatccttaagaatagtttaatcaacgctttaagttttacataattggttataattgtacagatatcatcccaatgttgggttggt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| | |
|
|
| T |
43928042 |
gtaaattatgttataaatccttaagaat------------------agttttacataattggttataattgtacagatatcatcccaatgttggattgat |
43928123 |
T |
 |
| Q |
243 |
ggccccttttttaaacgtataatgcattaat |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
43928124 |
ggccccttttttaaacgtataatgcattaat |
43928154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University