View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5458_low_9 (Length: 248)

Name: NF5458_low_9
Description: NF5458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5458_low_9
NF5458_low_9
[»] chr7 (1 HSPs)
chr7 (76-230)||(17294326-17294480)
[»] chr8 (1 HSPs)
chr8 (148-222)||(27712058-27712132)


Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 76 - 230
Target Start/End: Complemental strand, 17294480 - 17294326
Alignment:
76 attttatattgtgcaaggtaggtatgatccaaaagaaactaagggacttgtgacttgcaataatagctggagatttttcatgcagaaaagttgcaacttc 175  Q
    |||||||||||||  ||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||    
17294480 attttatattgtgagaggtaggtatgatccaaaagaaactaaaggaattgtgacttgcaataatagctagagatttttcatgcagaaaagttgcaacttc 17294381  T
176 aaacatgagcacaaccaatcttgataaactgaaagctgcggctgaagcgggtaat 230  Q
    ||||||||||||||||||||||||||||||||||| ||| |||||||||||||||    
17294380 aaacatgagcacaaccaatcttgataaactgaaagttgcagctgaagcgggtaat 17294326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 148 - 222
Target Start/End: Original strand, 27712058 - 27712132
Alignment:
148 atttttcatgcagaaaagttgcaacttcaaacatgagcacaaccaatcttgataaactgaaagctgcggctgaag 222  Q
    |||||||||||  || || ||||| |||||| |||| | ||||||||||| |||||||||||| ||| |||||||    
27712058 atttttcatgccaaagaggtgcaatttcaaaaatgaacccaaccaatcttcataaactgaaagttgcagctgaag 27712132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University