View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5458_low_9 (Length: 248)
Name: NF5458_low_9
Description: NF5458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5458_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 76 - 230
Target Start/End: Complemental strand, 17294480 - 17294326
Alignment:
| Q |
76 |
attttatattgtgcaaggtaggtatgatccaaaagaaactaagggacttgtgacttgcaataatagctggagatttttcatgcagaaaagttgcaacttc |
175 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| ||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
17294480 |
attttatattgtgagaggtaggtatgatccaaaagaaactaaaggaattgtgacttgcaataatagctagagatttttcatgcagaaaagttgcaacttc |
17294381 |
T |
 |
| Q |
176 |
aaacatgagcacaaccaatcttgataaactgaaagctgcggctgaagcgggtaat |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
17294380 |
aaacatgagcacaaccaatcttgataaactgaaagttgcagctgaagcgggtaat |
17294326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 148 - 222
Target Start/End: Original strand, 27712058 - 27712132
Alignment:
| Q |
148 |
atttttcatgcagaaaagttgcaacttcaaacatgagcacaaccaatcttgataaactgaaagctgcggctgaag |
222 |
Q |
| |
|
||||||||||| || || ||||| |||||| |||| | ||||||||||| |||||||||||| ||| ||||||| |
|
|
| T |
27712058 |
atttttcatgccaaagaggtgcaatttcaaaaatgaacccaaccaatcttcataaactgaaagttgcagctgaag |
27712132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University