View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5459-Insertion-4 (Length: 577)
Name: NF5459-Insertion-4
Description: NF5459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5459-Insertion-4 |
 | |
|
| [»] chr6 (4 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 96; Significance: 2e-47; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 96; E-Value: 2e-47
Query Start/End: Original strand, 437 - 577
Target Start/End: Complemental strand, 34859413 - 34859272
Alignment:
| Q |
437 |
ttttacraaaggattgaaatggatgtgtacccttttattgaccatg-acaaatttatcgaatgtgggaaattgaaaattaaacctttgtttggtaagtga |
535 |
Q |
| |
|
|||||| ||||||||||||| || ||||| ||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
34859413 |
ttttacaaaaggattgaaattgaattgtactcttttattgaccatgcacacctttatcgaatgtgggaaattgaaaattaaacctttgtttggtaagtaa |
34859314 |
T |
|
| Q |
536 |
gtaaactaaaaatgtgagcatgtgaagacttgtcatgccaac |
577 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
34859313 |
gtaaactaaaaatgtgagcatgtgaagacttatcatgtcaac |
34859272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 263 - 315
Target Start/End: Complemental strand, 34859636 - 34859584
Alignment:
| Q |
263 |
tagttatatgattgtctttctatgaatttggttacaaakattttatgacaaca |
315 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| ||| |||||||||| |
|
|
| T |
34859636 |
tagttatatgattgtctttctatgaatttcgttacaaatattctatgacaaca |
34859584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 200 - 262
Target Start/End: Complemental strand, 34859787 - 34859723
Alignment:
| Q |
200 |
atggttat-agtatgtwaagacgagttgaagattawagccaat-aaatgacacaattgttgaagg |
262 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
34859787 |
atggttatcagtatgttaagacgagttgaagattaaagccaatccaatgacacaattgttgaagg |
34859723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 361 - 411
Target Start/End: Complemental strand, 34859531 - 34859480
Alignment:
| Q |
361 |
agaaatttgtttta-attcmaaattgggtttgaaccggaatctacctgaatt |
411 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| || ||||||||| |
|
|
| T |
34859531 |
agaaatttgttttatattctaaattgggtttgaaccggattcaacctgaatt |
34859480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University