View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5459_high_2 (Length: 249)
Name: NF5459_high_2
Description: NF5459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5459_high_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 68 - 180
Target Start/End: Original strand, 22046108 - 22046220
Alignment:
| Q |
68 |
ttatgttggtaggaaaaatggaagttcatgaactaatatgtaattattagatactataataatggaagtagatagtgaaatggatgaaaaaattaggtca |
167 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22046108 |
ttattttggtaggaaaaatggaagttcatgaactaatatgtaattattaaatacgataataatggaagtagatagtgaaatggatgaaaaaattatgtca |
22046207 |
T |
|
| Q |
168 |
aaatgtaatctat |
180 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
22046208 |
aaatttaatctat |
22046220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 90 - 146
Target Start/End: Original strand, 22072578 - 22072634
Alignment:
| Q |
90 |
agttcatgaactaatatgtaattattagatactataataatggaagtagatagtgaa |
146 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
22072578 |
agttcatgaactaacatgtaattattagatactataataacggaagtagatagtgaa |
22072634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 208 - 241
Target Start/End: Original strand, 22046225 - 22046258
Alignment:
| Q |
208 |
tctgcaaattatattaaaaattatggagtattat |
241 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
22046225 |
tctgcaaattatattaaaaattatggattattat |
22046258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University