View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5459_high_5 (Length: 227)
Name: NF5459_high_5
Description: NF5459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5459_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 8 - 206
Target Start/End: Original strand, 22045895 - 22046092
Alignment:
| Q |
8 |
gtacaacatcatgaatattctcaacttaagtacaaatctatgggtataatggttgatatgattgtagctttgtgttatattttggcataaaagagtatca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | | |||| |||||||||||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
22045895 |
gtacaacatcatgaatattctcaacttaagtacaaatcaa-gagtatgatggttgatatgatagtagctttgtgttatattttagcataaaagagtatca |
22045993 |
T |
 |
| Q |
108 |
aagatacgaattactttgtacgactaaagaagagcaaatattcggatcataaattggaagaaaattggnnnnnnnnnntcaattactattgtggattat |
206 |
Q |
| |
|
||| | |||||||||||||||| |||||||||| || |||||||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
22045994 |
aaggcatgaattactttgtacgaataaagaagaggaagtattcggatcataaattggatgaaaattggaaaaaaaaaatcaattactattgtggattat |
22046092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University