View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5460-Insertion-10 (Length: 253)
Name: NF5460-Insertion-10
Description: NF5460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5460-Insertion-10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 8 - 213
Target Start/End: Original strand, 7234069 - 7234274
Alignment:
| Q |
8 |
ctttcttcatcttcaatccatcatcattatcaaaaacttctaaacttttccctttggacataacatctgaagaaacaacatcaccaaattccaacttctt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |||||||| |
|
|
| T |
7234069 |
ctttcttcatcttcaatccatcatcattatcaaaaacttctaaacttttccctttggacataacatctgaagaaacaacattaccaaaatctaacttctt |
7234168 |
T |
|
| Q |
108 |
tggttttttgttcattttcacaatttcagaactattagtgataaactttttcccttcaatcttagaaactaaatgagttaacggcgcttcgaattccaaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7234169 |
tggttttttgttcattttcacaatttcagaactattagtgataaactttttcccttcaatcttagaaactaaatgagttaacggcgcttcgaattccaaa |
7234268 |
T |
|
| Q |
208 |
gaattc |
213 |
Q |
| |
|
|||||| |
|
|
| T |
7234269 |
gaattc |
7234274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University