View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5460_low_4 (Length: 290)
Name: NF5460_low_4
Description: NF5460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5460_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 8e-98; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 41861395 - 41861163
Alignment:
| Q |
1 |
taacagggaggaattgttggatctttagaaggaaattgttggttttataaaatatcaggtataatctttatacatatatct-------------ccatat |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41861395 |
taacagggaggaattgttggatctttagaaggaaattgttggttttataaaatatcaggtataatctttatacatatatcttgcccatatatctccatat |
41861296 |
T |
 |
| Q |
88 |
tccatttaagttattttttgacccttcgatttttggtacttctgaaatgtagttagttttaataatcaaaatgttaggttttgctattaaaccatagatt |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41861295 |
tccatttaagttattttttgacccttcgatttttggtacttctgaaatgtagttagttttaataatcaaaatgttaggttttgctattaaaccgtagatt |
41861196 |
T |
 |
| Q |
188 |
tcgaataagaagtaacaagattaagtctaccgc |
220 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| |
|
|
| T |
41861195 |
ttgaataagaagtaacaagattaagtctaccgc |
41861163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 204 - 271
Target Start/End: Complemental strand, 41861145 - 41861078
Alignment:
| Q |
204 |
aagattaagtctaccgcaaaatgttaatcaagttatattgggatgttgtgattttcattagtctttta |
271 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
41861145 |
aagattaagtctaccgcaaaatattaatcaagttatattgggatgttgtcattttcattagtctttta |
41861078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University