View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5461_high_21 (Length: 345)

Name: NF5461_high_21
Description: NF5461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5461_high_21
NF5461_high_21
[»] chr4 (1 HSPs)
chr4 (46-278)||(6246239-6246470)


Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 46 - 278
Target Start/End: Complemental strand, 6246470 - 6246239
Alignment:
46 acaaagaccaacctaaattatggaagcagataatagagatatacctacagaatgttttgaaaattcttctt---ttgacaggctaaatcttaccgaacat 142  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||    
6246470 acaaagaccaacctaaattatggaagcagataatagagagatacctacagaatgttttgaaaattcttcttcttttgacaggctaaatcttaccgaacat 6246371  T
143 tggaatctaccaactgcttaaacaaagaaacaaacaaaaaaggaaaggtaactgactaagtgtgtgtgcgcacgtgacaagcagtaattaaattaggaaa 242  Q
    ||||||||||||||||||||||||||||||||||    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6246370 tggaatctaccaactgcttaaacaaagaaacaaa----aaaggaaaggtaactgactaagtgtgtgtgcgcacgtgacaagcagtaattaaattaggaaa 6246275  T
243 cccaaattccacgaatctaataaccctaaccataca 278  Q
    ||||||||||||||||||||||||||||||||||||    
6246274 cccaaattccacgaatctaataaccctaaccataca 6246239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University