View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5461_high_22 (Length: 332)
Name: NF5461_high_22
Description: NF5461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5461_high_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 16 - 317
Target Start/End: Original strand, 29582139 - 29582440
Alignment:
| Q |
16 |
atcacaacggatacatcgaattcgacgagcttgttaatgctattatgcccgacatgaatgaggatgttctcatcaatcaagaacaacttttggaggtttt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29582139 |
atcacaacggatacatcgaattcgacgagcttgttaatgctattatgcccgacatgaatgaggatgttctcatcaatcaagaacaacttttggaggtttt |
29582238 |
T |
|
| Q |
116 |
tcgctcgtttgatcgcgatggtaacggttacatcaccgcggctgagcttgccggatccatggcaaagatgggccatcctctaacataccatgagcttgct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29582239 |
tcgctcgtttgatcgcgatggtaacggttacatcaccgcggctgagcttgccggatccatggcaaagatgggccatcctctaacataccatgagcttgct |
29582338 |
T |
|
| Q |
216 |
aacatgatggctgaagctgatagcaatggtgatggtgttattagtttcaatgagtttgctaccattttggctaaatcagctgctgattttcttggtgtta |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29582339 |
aacatgatggctgaagctgatagcaatggtgatggtgttattagtttcaatgagtttgctaccattttggctaaatcagctgctgattttcttggtgtta |
29582438 |
T |
|
| Q |
316 |
ag |
317 |
Q |
| |
|
|| |
|
|
| T |
29582439 |
ag |
29582440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 241 - 304
Target Start/End: Original strand, 46040907 - 46040970
Alignment:
| Q |
241 |
atggtgatggtgttattagtttcaatgagtttgctaccattttggctaaatcagctgctgattt |
304 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||| ||| ||||| ||| ||| ||||||| |
|
|
| T |
46040907 |
atggtgatggtgttattagttttagtgagtttgctactattatggctcgatctgcttctgattt |
46040970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University