View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5461_high_36 (Length: 240)
Name: NF5461_high_36
Description: NF5461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5461_high_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 9413579 - 9413800
Alignment:
| Q |
1 |
aaagaagtagttccaacaggaagagtaatacttgcataaatcgtaacctcgttattttcatgtgtagcactcaaccttgaatgaggataactaatattac |
100 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
9413579 |
aaagaaggagttccaacaggaagagtaatacttgcataaatcgtaacctcgttattttcatgtgtagcaatcaaccctgaatgaggataactaatattac |
9413678 |
T |
|
| Q |
101 |
tctctgctaattgtgtccctgaaccggcaattgatgaagtataagctttaggagttccactagattgtggaattgcaaccaaagcttgtgctccattcat |
200 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9413679 |
tctctgctaattgtgtccttgaattggcaattgatgaagtataagctttaggagttccactagattgtagaattgcaaccaaagcttgtgctccattcat |
9413778 |
T |
|
| Q |
201 |
ggaagatgtgagatcattgttt |
222 |
Q |
| |
|
|||||||| ||||||||||||| |
|
|
| T |
9413779 |
ggaagatgcgagatcattgttt |
9413800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University