View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5461_high_37 (Length: 239)
Name: NF5461_high_37
Description: NF5461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5461_high_37 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 9 - 239
Target Start/End: Complemental strand, 43868526 - 43868296
Alignment:
| Q |
9 |
acatcatcacttgtcatgtcaaaaactgattccaaatcatcaagttcttcatccttaacctttaacatttcatttttggatgcatccatttcattctctt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43868526 |
acatcatcacttgtcatgtcaaaaactgattccaaatcatcaagttcttcatccttaacctttaacatttcacttttggatgcatccatttcattctctt |
43868427 |
T |
 |
| Q |
109 |
gtttataatcaaacacttgtcctgatgaattctcttgaatctcactactcccaacaccaagtaaactttcaacattagctgcaaattcagcaagatcaac |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43868426 |
gtttataatcaaacacttgtcctgatgaattctcttgaatctcactactcccaacaccaagtaaactttcaacattagctgcaaattcagcaagatcaac |
43868327 |
T |
 |
| Q |
209 |
atcaaactcacagaaactatccaagtcacac |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
43868326 |
atcaaactcacagaaactatccaagtcacac |
43868296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University