View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5461_low_17 (Length: 380)
Name: NF5461_low_17
Description: NF5461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5461_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 4e-51; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 16 - 146
Target Start/End: Complemental strand, 1356719 - 1356589
Alignment:
| Q |
16 |
attttgggtaatgaaaaggttgatgtttatgttnnnnnnnnggtatggttatgggattgtaggatctcagcaggaggagaagttgaagtggggtaggtgg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1356719 |
attttgggtaatgaaaaggttgatgtttatgttaaaaaaaaggtatggttatgggattgtaggatctcagcaggaggagaagttgaagtggggtaggtgg |
1356620 |
T |
|
| Q |
116 |
aggtggagaaaacttcggaaatggcggatca |
146 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |
|
|
| T |
1356619 |
aggtggagaaaactttggaaatggcggatca |
1356589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 152 - 253
Target Start/End: Complemental strand, 1356529 - 1356429
Alignment:
| Q |
152 |
cataactagcagcaacataatgccaagtttgtgaatgagtcagagtttgagaaaaggaaattatatagttttgaaaaagagaactgaggtaagatgtgtt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
1356529 |
cataactagcagcaacataatgccaagtttgtgaatgagtgagagtttgagaaaaggaaattatatagttttg-aaaagagaactgaggaaagatgtgtt |
1356431 |
T |
|
| Q |
252 |
gt |
253 |
Q |
| |
|
|| |
|
|
| T |
1356430 |
gt |
1356429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University