View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5461_low_19 (Length: 362)
Name: NF5461_low_19
Description: NF5461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5461_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 1 - 261
Target Start/End: Complemental strand, 29582163 - 29581903
Alignment:
| Q |
1 |
tcgaattcgatgtatccgttgtgagtgttgtccatgttgttgagtagggcataaagttcatcgcctgttggtttgatgccgagggagcggaggagtgccg |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29582163 |
tcgaattcgatgtatccgttgtgattgttgtccatgttgttgagtagggcataaagttcatcgcctgttggtttgatgccgagggagcggaggagtgccg |
29582064 |
T |
|
| Q |
101 |
cgagctcgaggtgggttaggctgccgtcggaatccatgtcaaaacgcttgaatatgtcgtttaattgtttgatttgatcatcggtttggagcattgacat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29582063 |
cgagctcgaggtgggttaggctgccgtcggaatccatgtcaaaacgcttgaatatgtcgtttaattgtttgatttgatcatcggtttggagcattgacat |
29581964 |
T |
|
| Q |
201 |
ggtggtaggttggtgaaggcctaggccttgaggaggagagaaaacttatagataaatcaaa |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29581963 |
ggtggtaggttggtgaaggcctaggccttgaggaggagagaaaacttatagatagatcaaa |
29581903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University