View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5461_low_21 (Length: 350)
Name: NF5461_low_21
Description: NF5461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5461_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 18 - 330
Target Start/End: Original strand, 12309345 - 12309652
Alignment:
| Q |
18 |
gttcgtactctatagacgtccagtgtcttctaagctctaagctccaagcttatagatctatctatacta--atccgtactcatactcgtcaaatataggt |
115 |
Q |
| |
|
||||||||||| | ||||||| ||||||||||||||||||||| ||||| |||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
12309345 |
gttcgtactctgttgacgtccggtgtcttctaagctctaagct-------tatagttctatctatattataatccgtactcatactcgtcaaatataggt |
12309437 |
T |
 |
| Q |
116 |
catacttacccccacacatttagctattgtgatggaatatgcttctggaggagagctatttgagcgaatatgcaatgcaggacggttcagcgaggatgag |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12309438 |
aatacttacccctacacatttagctattgtgatggaatatgcttccggaggagagctatttgagcgaatatgcaatgcaggacggttcagcgaggatgag |
12309537 |
T |
 |
| Q |
216 |
gttcttatcatattcaatacatggattttgaatgcagtactgctgctgcggttaacgttagtgaccgttatttgtgctgcaggcacggtttttcttccaa |
315 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12309538 |
gttctaatcatattcaattcatggattttgaatgcagtaccgctgctgcggttaacgttagtgaccgttatttgtgctgcaggcacggtttttcttccaa |
12309637 |
T |
 |
| Q |
316 |
caacttatatcaggg |
330 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
12309638 |
caacttatatcaggg |
12309652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 147 - 224
Target Start/End: Original strand, 34077716 - 34077793
Alignment:
| Q |
147 |
atggaatatgcttctggaggagagctatttgagcgaatatgcaatgcaggacggttcagcgaggatgaggttcttatc |
224 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||||||||| || || ||||| ||||||||||||| |||| |
|
|
| T |
34077716 |
atggaatatgcttccgggggagagctatttgagcgaatatgcaatgcggggcgattcagtgaggatgaggttcgtatc |
34077793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 129 - 218
Target Start/End: Complemental strand, 44633090 - 44633001
Alignment:
| Q |
129 |
acacatttagctattgtgatggaatatgcttctggaggagagctatttgagcgaatatgcaatgcaggacggttcagcgaggatgaggtt |
218 |
Q |
| |
|
||||||||||| ||||||||||| ||||| |||||||||| || |||||| | ||||||||||| || ||||||| || ||||||||| |
|
|
| T |
44633090 |
acacatttagcaattgtgatggagtatgcagctggaggagaactctttgagaggatatgcaatgctggcaggttcagtgaagatgaggtt |
44633001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University