View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5461_low_29 (Length: 327)
Name: NF5461_low_29
Description: NF5461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5461_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 149 - 308
Target Start/End: Original strand, 230639 - 230798
Alignment:
| Q |
149 |
catgatcatgaggtttgttactagctaccaaacatttccagcttaatcacactttgataactgataatgatcgatgctttcatccatgtgtacctacgta |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
230639 |
catgatcatgaggtttgttactagctaccaaacatttccagcttaatcacactttgataactgataatgatcgatgctttcatccatgtgtacgtacgta |
230738 |
T |
 |
| Q |
249 |
taatggaatgttacaaacgacataataacaactaacaacgacctctttcacccctgctgg |
308 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
230739 |
taatggaatgtcacaaacgacataataacaactaacaatgacctctttcacccctgctgg |
230798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 36 - 105
Target Start/End: Original strand, 230529 - 230598
Alignment:
| Q |
36 |
tgagtgagtgggtgagttttgaagacttaaaagagtttgttggcatgagagaggttaaataggcagcaga |
105 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
230529 |
tgagtgagtgagtgagttttgaagacttaaaagagtttgttggcatgagagaggttaaataggcagcaga |
230598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University