View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5461_low_39 (Length: 244)
Name: NF5461_low_39
Description: NF5461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5461_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 15 - 224
Target Start/End: Original strand, 3469542 - 3469751
Alignment:
| Q |
15 |
gagatgaacggtcgtctgcaagaagaatcgaaactggagaccgaagagctgcggccggggaagagagattctccggtttgcaaaggaaacaaataatatc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3469542 |
gagatgaacggtcgtctgcaagaagaatcggaactggagaccgaagagctgcggccggggaagagagattctccggtctgcaaaggaaacaaataatatc |
3469641 |
T |
 |
| Q |
115 |
gaccatgcaaacttttccgatacatttgcaatgaaattcaaagtcctctttgattagggtttgaggaggttttctgttgatggaatggtgacaattccaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3469642 |
gaccatgcaaacttttccgatacatttgcaatgaaattcaaagtcctctttgattagggtttgaggaggttttctgttgatggaatggtgacaattccaa |
3469741 |
T |
 |
| Q |
215 |
acgctgatgt |
224 |
Q |
| |
|
|||||||||| |
|
|
| T |
3469742 |
acgctgatgt |
3469751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 80 - 129
Target Start/End: Original strand, 33554729 - 33554778
Alignment:
| Q |
80 |
agattctccggtttgcaaaggaaacaaataatatcgaccatgcaaacttt |
129 |
Q |
| |
|
||||| || |||||||||||| ||||||||| ||| |||||||||||||| |
|
|
| T |
33554729 |
agattttctggtttgcaaaggtaacaaataacatcaaccatgcaaacttt |
33554778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University