View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5461_low_44 (Length: 236)

Name: NF5461_low_44
Description: NF5461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5461_low_44
NF5461_low_44
[»] chr4 (1 HSPs)
chr4 (149-222)||(43210792-43210865)


Alignment Details
Target: chr4 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 149 - 222
Target Start/End: Original strand, 43210792 - 43210865
Alignment:
149 ccctccaagcgagtatcatttgttgtgtgtgaactgtgctcagcatcgcgtgggtgattaacgaacggcgtttt 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43210792 ccctccaagcgagtatcatttgttgtgtgtgaactgtgctcagcatcgcgtgggtgattaacgaacggcgtttt 43210865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University