View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5461_low_48 (Length: 227)
Name: NF5461_low_48
Description: NF5461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5461_low_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 127 - 211
Target Start/End: Original strand, 14869407 - 14869490
Alignment:
| Q |
127 |
tcattgacaatcaatgtctttgatactcatatcaacctattgtaaaaaatcaaataaatagtaacactgaaatgaaagatgaatt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14869407 |
tcattgacaatcaatgtctttgatactcatatcaac-tattgtaaaaaatcaaataaatagtaacactgaaatgaaagatgaatt |
14869490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 15 - 68
Target Start/End: Original strand, 14869222 - 14869275
Alignment:
| Q |
15 |
agcacagattaaaatagtaaaaatttaaaataagttttgaatgaagtctaattg |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14869222 |
agcacagattaaaatagtaaaaatttaaaataagttttgaatgaagtctaattg |
14869275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University