View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5462_high_3 (Length: 380)
Name: NF5462_high_3
Description: NF5462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5462_high_3 |
 |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 19 - 373
Target Start/End: Original strand, 35829783 - 35830137
Alignment:
| Q |
19 |
agatgctgcaaaggactttggcaacatacaccgttttcctcctctagcagtgttgcatccaaaaactgtttcagatatttcacgtaccgtaaaacatatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35829783 |
agatgctgcaaaggactttggcaacatacaccattttcctcctctagcagtgttacatccaaaaactgtttcagatatttcacgtaccgtaaaacatatt |
35829882 |
T |
 |
| Q |
119 |
tttgaaaaaggatctgattcagagttgaaggtagctgctagaggccatggacattcccttcaaggtcaagcacaagcacatcaaggactagtcatcaaaa |
218 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35829883 |
tttgaaaaagggtctgattcagagttgaaggtagctgctagaggccatggacattcccttcaaggtcaagcacaagcacatcaaggactagtcatcaaaa |
35829982 |
T |
 |
| Q |
219 |
tggagtcacttcagagtcctgaaatgaaaattcagaccggtgaatttccttttgtcgatgtctcaggtggtgagttgtggataaacattctgcatgagac |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35829983 |
tggagtcacttcagagtcctgaaatgaaaattcagaccggtgaatttccttttgtcgatgtctcaggtggtgagttgtggataaacattctgcatgagac |
35830082 |
T |
 |
| Q |
319 |
tctaaaacatggattgtcaccaaaatcttggacagactatcttcatctcattgtt |
373 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35830083 |
tctaaaacatggattggcaccaaaatcttggacagactatcttcatctcactgtt |
35830137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 275 - 354
Target Start/End: Original strand, 54354 - 54433
Alignment:
| Q |
275 |
gatgtctcaggtggtgagttgtggataaacattctgcatgagactctaaaacatggattgtcaccaaaatcttggacaga |
354 |
Q |
| |
|
|||||||| |||||||| |||||||||||||| ||||||||||| | ||| |||| ||| |||||| ||| |||||||| |
|
|
| T |
54354 |
gatgtctctggtggtgaattgtggataaacatcttgcatgagactttgaaatatgggttggcaccaagatcatggacaga |
54433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 275 - 354
Target Start/End: Complemental strand, 14785376 - 14785297
Alignment:
| Q |
275 |
gatgtctcaggtggtgagttgtggataaacattctgcatgagactctaaaacatggattgtcaccaaaatcttggacaga |
354 |
Q |
| |
|
|||||||| |||||||| |||||||||||||| ||||||||||| | ||| |||| ||| |||||| ||| |||||||| |
|
|
| T |
14785376 |
gatgtctctggtggtgaattgtggataaacatcttgcatgagactttgaaatatgggttggcaccaagatcatggacaga |
14785297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 260 - 354
Target Start/End: Complemental strand, 13415528 - 13415434
Alignment:
| Q |
260 |
gaatttccttttgtcgatgtctcaggtggtgagttgtggataaacattctgcatgagactctaaaacatggattgtcaccaaaatcttggacaga |
354 |
Q |
| |
|
|||||||||| ||| ||||| ||||| ||||| || |||||||| ||| |||||||||| | || |||| ||| |||||| |||||||||||| |
|
|
| T |
13415528 |
gaatttccttatgtggatgtgtcaggaggtgaattatggataaagattttgcatgagacattgaagtatggtttggcaccaagatcttggacaga |
13415434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University