View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5463_low_12 (Length: 267)
Name: NF5463_low_12
Description: NF5463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5463_low_12 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 13 - 267
Target Start/End: Original strand, 40819988 - 40820242
Alignment:
| Q |
13 |
aatattgaaaaataattcgggaacttccagacgaatttcgctccacaagtttgttgcattccaacaatctttgtggtgagcacatccaaagaacatgtga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
40819988 |
aatattgaaaaataattcgggaacttccagacgaatttcgctccacaagtttgttgcattccaacaatctttgtagtgagcatatccaaagaacatgtga |
40820087 |
T |
 |
| Q |
113 |
atatcatactctactgcattatcacacatcacacatgtcatttggaaaaggacacctccatggtggaagttgaatctggtgggaaggcaaaactggagta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
40820088 |
atatcatactctactgcattatcacacatcacacatgtcatttggaaaagaacacctccatggtggaggttgaatctggtgggaaggcaaaactggagta |
40820187 |
T |
 |
| Q |
213 |
aacggcaacaaaaatgtttgatttttggaggtaatggcaacgatcaagcctcatt |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40820188 |
aacggcaacaaaaatgtttgatttttggaggtaatggcaacgatcaagcctcatt |
40820242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University