View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5464-Insertion-4 (Length: 290)
Name: NF5464-Insertion-4
Description: NF5464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5464-Insertion-4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 150 - 274
Target Start/End: Complemental strand, 41503414 - 41503290
Alignment:
| Q |
150 |
gttaaattttgaatgaattttgtcatggagtatcaatatccaaccaaagttcaatgtgtttatgaattaaaattaaaataaaagagcaaagctatccatg |
249 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
41503414 |
gttaaattttgaatgaattttgtcacggagtatcaatatccaaccaaagttcaatgtgtttatgaataaaaataaaaataaaagagcaaagctatccatg |
41503315 |
T |
|
| Q |
250 |
aaatcagtggtaccgaatatattta |
274 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
41503314 |
aaatcagtggtaccgaatatattta |
41503290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 11 - 66
Target Start/End: Complemental strand, 41503559 - 41503504
Alignment:
| Q |
11 |
gttaaaaaagaattgaacacaatagtactttgagtttaattagatacatatctatc |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41503559 |
gttaaaaaagaattgaacacaatagtactttgagtttaattagatacatatctatc |
41503504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University