View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5464_low_10 (Length: 201)
Name: NF5464_low_10
Description: NF5464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5464_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 4e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 4e-86
Query Start/End: Original strand, 1 - 186
Target Start/End: Original strand, 11800737 - 11800924
Alignment:
| Q |
1 |
aagaaattgataaatgatagaatagaatcaatttaattat--gttaagcatgcaatattgggaaacaaaatcttattcttgatcttatttttagtcttga |
98 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
11800737 |
aagaaattgataaatgatagaatagattcaatttaattatatgttaagaatgcaatattgggaaacaaaatcttattcttgttcttatttttagtcttga |
11800836 |
T |
 |
| Q |
99 |
tttgtgcacccatcttgtgtaggagctattgttttttaaatttaaaataacaacactaaactaagtgtttggtgcccaatcctatgct |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11800837 |
tttgtgcacccatcttgtgtaggagctattgtttttaaaatttaaaataacaacactaaactaagtgtttggtgcccaatcctatgct |
11800924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University