View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5464_low_6 (Length: 272)
Name: NF5464_low_6
Description: NF5464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5464_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 25 - 99
Target Start/End: Complemental strand, 23267711 - 23267637
Alignment:
| Q |
25 |
ctctgcttggtaattgctccttgttggcctcctaaataaagggataaacgaaattctaattccaaggttggtcaa |
99 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| | |||||||||| |
|
|
| T |
23267711 |
ctctgcttggtaattgctctttgttggcctcctaaataaagggataaacgaacttctaattgtagggttggtcaa |
23267637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 190 - 225
Target Start/End: Complemental strand, 23254321 - 23254286
Alignment:
| Q |
190 |
tataattgatctcggaagcctcgattaatttctcta |
225 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
23254321 |
tataattgatctcggaagccttgattaatttctcta |
23254286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University