View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5464_low_6 (Length: 272)

Name: NF5464_low_6
Description: NF5464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5464_low_6
NF5464_low_6
[»] chr4 (2 HSPs)
chr4 (25-99)||(23267637-23267711)
chr4 (190-225)||(23254286-23254321)


Alignment Details
Target: chr4 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 25 - 99
Target Start/End: Complemental strand, 23267711 - 23267637
Alignment:
25 ctctgcttggtaattgctccttgttggcctcctaaataaagggataaacgaaattctaattccaaggttggtcaa 99  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||  | ||||||||||    
23267711 ctctgcttggtaattgctctttgttggcctcctaaataaagggataaacgaacttctaattgtagggttggtcaa 23267637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 190 - 225
Target Start/End: Complemental strand, 23254321 - 23254286
Alignment:
190 tataattgatctcggaagcctcgattaatttctcta 225  Q
    ||||||||||||||||||||| ||||||||||||||    
23254321 tataattgatctcggaagccttgattaatttctcta 23254286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University