View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5465_high_12 (Length: 228)
Name: NF5465_high_12
Description: NF5465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5465_high_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 7 - 213
Target Start/End: Original strand, 2429525 - 2429729
Alignment:
| Q |
7 |
gttctcactctctccctctctagcttaacaaacacaactttgattctatctcaacagtgtggaaattcttcattcttaaactttgttggggcnnnnnnnn |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2429525 |
gttctcactctctccctctctagcttaacaaacacaactttgattctatctcaacagtgtggaaattcttcattcttaaactttgttgggg--tattttt |
2429622 |
T |
 |
| Q |
107 |
nnattaaaagttgtcgatttcaaatataaaaagtatggaacaatttgcaaattttaaatttagagaccaatttacaaatttgaataattataaggaccaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2429623 |
ttattaaaagttgtcgatttcaaatataaaaagtatgtaccaatttgcaaattttaaatttagagaccaatttacaaatttgaataattataaggaccaa |
2429722 |
T |
 |
| Q |
207 |
ttcgcaa |
213 |
Q |
| |
|
||||||| |
|
|
| T |
2429723 |
ttcgcaa |
2429729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University