View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5465_low_14 (Length: 240)
Name: NF5465_low_14
Description: NF5465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5465_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 26 - 236
Target Start/End: Original strand, 33536564 - 33536775
Alignment:
| Q |
26 |
caacccttccgcctcctgctcaattccatcagctgcgtcgtttacaacaaacatatgctattgctgaagtgtattccctacaacttcaacattgctccaa |
125 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| || ||| ||||||||||||||||||||||| | | |||||||||||||||||| |
|
|
| T |
33536564 |
caacccttccgcctcctgctcaatttcatcagctgcgtcgtttacatcatacacatgctattgctgaagtgtattccttgctacttcaacattgctccaa |
33536663 |
T |
 |
| Q |
126 |
tacttcccaggcgtcaatgagcattctcctgacttgtcggagg-attacattctctgcttgatctgcagttgtctaacatgtttgcaacaccttctcgat |
224 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
33536664 |
tacttcccaagcgtcaatgagcattcccctgactttctggaggaattacattctctgcttgatctgcagttgtctaacatgtttgcaacaccttccagat |
33536763 |
T |
 |
| Q |
225 |
tacctccgcatc |
236 |
Q |
| |
|
|||||||||||| |
|
|
| T |
33536764 |
tacctccgcatc |
33536775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University