View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5465_low_16 (Length: 222)
Name: NF5465_low_16
Description: NF5465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5465_low_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 2429985 - 2430198
Alignment:
| Q |
1 |
aaaaaatggtaaatatagatgttgttgttagtattttttaagtcttaaggtcttctctactttgaaatggaacatcatccttccatcctagttttttctc |
100 |
Q |
| |
|
|||||| |||||||||||||||| |||||||| |||||||| |||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2429985 |
aaaaaaaggtaaatatagatgtttttgttagtgttttttaaatcttaaggtcttctctgctttgaaatgggacatcatccttccatcctagttttttctc |
2430084 |
T |
 |
| Q |
101 |
attnnnnnnnnnntttccatgaacttatgatcaattatgcttacttacatctcataaaaattaattctaacaaaatgaagaatgggaaaggtagaatatt |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
2430085 |
attaaaaaaaaaaattccatgaacttatgatcaattatgcttacttacatctcataaaaattaattctaacaaaatgaagaatgagaaaggtagactatt |
2430184 |
T |
 |
| Q |
201 |
ttccgcccctatga |
214 |
Q |
| |
|
||||| |||||||| |
|
|
| T |
2430185 |
ttccgtccctatga |
2430198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University